Алгоритм Бойера-Мура

Материал из Викиконспекты
Перейти к: навигация, поиск

Алгоритм Бойера-Мура, разработанный двумя учеными — Бойером (Robert S. Boyer) и Муром (J. Strother Moore), считается наиболее быстрым среди алгоритмов общего назначения, предназначенных для поиска подстроки в строке. Важной особенностью алгоритма является то, что он выполняет сравнения в шаблоне справа налево в отличие от многих других алгоритмов.

Алгоритм Бойера-Мура считается наиболее эффективным алгоритмом поиска шаблонов в стандартных приложениях и командах, таких как Ctrl+F в браузерах и текстовых редакторах.

Алгоритм[править]

Алгоритм сравнивает символы шаблона [math]x[/math] справа налево, начиная с самого правого, один за другим с символами исходной строки [math]y[/math]. Если символы совпадают, производится сравнение предпоследнего символа шаблона и так до конца. Если все символы шаблона совпали с наложенными символами строки, значит, подстрока найдена, и поиск окончен. В случае несовпадения какого-либо символа (или полного совпадения всего шаблона) он использует две предварительно вычисляемых эвристических функций, чтобы сдвинуть позицию для начала сравнения вправо.

Таким образом для сдвига позиции начала сравнения алгоритм Бойера-Мура выбирает между двумя функциями, называемыми эвристиками хорошего суффикса и плохого символа (иногда они называются эвристиками совпавшего суффикса и стоп-символа). Так как функции эвристические, то выбор между ними простой — ищется такое итоговое значение, чтобы мы не проверяли максимальное число позиций и при этом нашли все подстроки равные шаблону.

Алфавит обозначим буквой [math]\Sigma[/math].

Пусть [math]|y|=n[/math], [math]|x|=m[/math] и [math]|\Sigma|=\sigma[/math].

Предположим, что в процессе сравнения возникает несовпадение между символом [math]x[i]=a[/math] шаблона и символом [math]y[i+j]=b[/math] исходного текста при проверке в позиции [math]j[/math]. Тогда [math]x[i+1 \dots m-1]=y[i+j+1 \dots j+m-1]=u[/math] и [math]x[i] \neq y[i+j][/math], и [math]m - i - 1[/math] символов шаблона уже совпало.

Правило сдвига хорошего суффикса[править]

Если при сравнении текста и шаблона совпало один или больше символов, шаблон сдвигается в зависимости от того, какой суффикс совпал.

Если существуют такие подстроки равные [math]u[/math], что они полностью входят в [math]x[/math] и идут справа от символов, отличных от [math]x[i][/math], то сдвиг происходит к самой правой из них, отличной от [math] u [/math]. Понятно, что таким образом мы не пропустим никакую строку, так как сдвиг просходит на следующую слева подстроку [math] u [/math] от суффикса. После выравнивания шаблона по этой подстроке сравнение шаблона опять начнется с его последнего символа. На новом шаге алгоритма можно строку [math] u [/math], по которой был произведён cдвиг, не сравнивать с текстом — возможность для модификации и дальнейшего ускорения алгоритма.

Сдвиг хорошего суффикса, вся подстрока [math]u[/math] полностью встречается справа от символа [math]c[/math], отличного от символа [math]a[/math].

Если не существует таких подстрок, то смещение состоит в выравнивании самого длинного суффикса [math]v[/math] подстроки [math]y[i+j+1 \dots j+m-1][/math] с соответствующим префиксом [math]x[/math]. Из-за того, что мы не смогли найти такую подстроку, то, очевидно, что ни один суффикс шаблона [math]x[/math] уже не будет лежать в подстроке [math]y[i+j+1 \dots j+m-1][/math], поэтому единственный вариант, что в эту подстроку попадет префикс.

Сдвиг хорошего суффикса, только суффикс подстроки [math]u[/math] повторно встречается в [math]x[/math].

Правило сдвига плохого символа[править]

В таблице плохих символов указывается последняя позиция в шаблоне (исключая последнюю букву) каждого из символов алфавита. Для всех символов, не вошедших в шаблон, пишем [math]m[/math]. Предположим, что у нас не совпал символ [math]c[/math] из текста на очередном шаге с символом из шаблона. Очевидно, что в таком случае мы можем сдвинуть шаблон до первого вхождения этого символа [math]c[/math] в шаблоне, потому что совпадений других символов точно не может быть. Если в шаблоне такого символа нет, то можно сдвинуть весь шаблон полностью.

Если символ исходного текста [math]y[i + j][/math] встречается в шаблоне [math]x[/math], то происходит его выравнивание с его самым правым появлением в подстроке [math]x[0 \dots m-2][/math].

Сдвиг плохого символа, символ [math]a[/math] входит в [math]x[/math].

Если [math]y[i+j][/math] не встречается в шаблоне [math]x[/math], то ни одно вхождение [math]x[/math] в [math]y[/math] не может включать в себя [math]y[i+j][/math], и левый конец окна сравнения совмещен с символом непосредственно идущим после [math]y[i+j][/math], то есть символ [math]y[i+j+1][/math].

Сдвиг плохого символа, символ [math]b[/math] не входит в [math]x[/math].

Обратите внимание, что сдвиг плохого символа может быть отрицательным, поэтому исходя из ранее приведенных свойств этих функций берется значение равное максимуму между сдвигом хорошего суффикса и сдвигом плохого символа.

Формальное определение[править]

Теперь определим две функции сдвигов более формально следующим образом:

Пусть значения функции сдвига хорошего суффикса хранятся в массиве [math]bmGs[/math] размером [math]m+1[/math].

Определим два условия:

  • [math]\mathrm{Cs}(i, s)[/math]: для каждого [math]k[/math] такого, что [math]i \lt k \lt m[/math] выполняется [math]s \geqslant k[/math] или [math]x[k-s]=x[k][/math]
  • [math]\mathrm{Co}(i, s)[/math]: если [math]s \lt i[/math], то выполняется [math]x[i-s] \neq x[i][/math]

Тогда для всех [math]i[/math] таких, что [math]0 \leqslant i \lt m[/math] выполняется [math]bmGs[i+1]=\min\{s \gt 0 : \mathrm{Cs}(i, s)\ \wedge\ \mathrm{Co}(i, s)\}[/math].

А значение [math]bmGs[0][/math] определим, как длину периода шаблона [math]x[/math].

Для вычисления [math] bmGs [/math] будем использовать функцию [math]\mathrm{suffixLength}[/math], определенную так: для всех [math]i[/math] таких, что [math]1 \leqslant i \lt m[/math] выполняется [math]\mathrm{suffixLength}(i)=\max\{k : x[i-k+1 \dots i]=x[m-k \dots m-1]\}[/math]

Сдвиги плохих символов будем хранить в массиве [math]bmBc[/math] размером [math]\sigma[/math]. Для каждого символа [math]c[/math] из [math]\Sigma[/math]: [math]bmBc[c] = \begin{cases} \min\{i : 1 \leqslant i \lt m-1\ \wedge\ x[m-1-i]=c\}, & \mbox{if } c \in x\\ m, & \mbox{otherwise} \end{cases}[/math]

Массивы [math]bmBc[/math] и [math]bmGs[/math] вычисляются за [math]O(m^2+\sigma)[/math] времени до основной фазы поиска и требуют, очевидно, [math]O(m+\sigma)[/math] памяти.

Псевдокод[править]

Константой [math]|\Sigma|=\sigma[/math] обозначим размер нашего алфавита.

Функция для вычисления таблицы сдвигов плохих символов. Она будет равна длине шаблона для всех символов, которые не встречаются в шаблоне, и порядковому номеру с конца для остальных (кроме последнего, для него тоже берется длина шаблона). Вычисляется прямо по определению за [math]O(m+\sigma)[/math].

  int[] preBmBc(char[m] x):
     int table[math][[/math] [math]|\Sigma|[/math] [math]][/math]
     // Заполняем значением по умолчанию, равным длине шаблона
     for i = 0 .. [math]|\Sigma|[/math] - 1
        table[i] = m
     // Вычисление функции по определению
     for i = 0 .. m - 2
        table[x[i]] = m - 1 - i
     return table

Функция, проверяющая, что подстрока [math]x[p \dots m - 1][/math] является префиксом шаблона [math]x[/math]. Требует [math]O(m - p)[/math] времени.

  boolean isPrefix(char[m] x, int p):
     int j = 0
     for i = p .. m - 1
        if x[i] != x[j]
           return false
        ++j
     return true

Функция, возвращающая для позиции [math]p[/math] длину максимальной подстроки, которая является суффиксом шаблона [math]x[/math]. Требует [math]O(m - p)[/math] времени. //здесь неправильно, нет смысла сравнивать элементы ШАБЛОНА С САМИМ СОБОЙ

  int suffixLength(char[m] x, int p):
     int len = 0
     int i = p
     int j = m - 1
     while i [math]\geqslant[/math] 0 and x[i] == x[j]
           ++len 
           --i
           --j
     return len

Функция для вычисления сдвигов хороших суффиксов. Требует [math]O(m)[/math] времени, несмотря на циклы в вызываемых функциях, из-за того, что каждый внутренний цикл в худшем случае будет выполняться на каждой позиции [math]i[/math] не больше, чем [math]i[/math] раз. Получается натуральный ряд, сумма [math]m[/math] первых членов которого [math]\frac{m \cdot (m - 1)}{2}[/math]. Следовательно, получается оценка по времени [math]O(m^2)[/math].

  int[] preBmGs(char[m] x):
     int table[m]
     int lastPrefixPosition = m
     for i = m - 1 .. 0
        // Если подстрока x[i+1..m-1] является префиксом, то запомним её начало
        if isPrefix(x, i + 1)
           lastPrefixPosition = i + 1
        table[m - 1 - i] = lastPrefixPosition - i + m - 1
     // Вычисление функции по определению
     for i = 0 .. m - 2
        int slen = suffixLength(x, i)
        table[slen] = m - 1 - i + slen
     return table

Основная функция алгоритма Бойера-Мура

  function BM(char[n] y, char[m] x): vector <int>
     vector <int> answer // вектор, содержащий все вхождения подстроки в строку
     if m == 0
        answer.pushBack(-1) // Искомая подстрока является пустой
        return answer 
     
     // Предварительные вычисления
     int[math][[/math] [math]|\Sigma|[/math] [math]][/math] bmBc = preBmBc(x)
     int[m] bmGs = preBmGs(x)
     
     // Поиск подстроки
     for i = m - 1 .. n - 1
        int j = m - 1
        while x[j] == y[i]
           if j == 0
              answer.pushBack(i) // Найдена подстрока в позиции i
           --i
           --j
        i += max(bmGs[m - 1 - j], bmBc[y[i]])
     if (answer == [math] \varnothing [/math])
        answer.pushBack(-1) // Искомая подстрока не найдена
     return answer

Пример[править]

Пусть нам дана строка [math]y = GCATCGCAGAGAGTATACAGTACG[/math] и образец [math]x=GCAGAGAG[/math].

Построим массивы [math]bmBc[/math] и [math]bmGs[/math] :

RaitaPre.png

Crochemore.png

Рассмотрим шаги алгоритма:

Изображение [math](j, bmGs[y[j]])[/math] Описание
BMexample1.png [math](7, 1)[/math] Сравниванием последние символы, они неравны, поэтому сдвигаемся на [math] bmGs[y[j]][/math], где [math]y[j][/math] — это не совпавший символ. В данном случае [math]y[j]=7[/math], а [math] bmGs[7]= 1[/math].
BMexample2.png [math](8, 4)[/math] Последние символы совпали. Предпоследние совпали. Третьи символы с конца различны, сдвигаемся на [math] bmGs[5]= 4[/math].
BMexample3.png [math](12, 7)[/math] Последние символы совпали, сравниваем далее. Строчка найдена. Продолжаем работу и сдвигаемся на [math] bmGs[0]= 7[/math].
BMexample4.png [math](19, 4)[/math] Последние символы совпали. Предпоследние совпали. Третьи символы с конца различны, сдвигаемся на [math] bmGs[5]= 4[/math].
BMexample5.png [math](23, 7)[/math] Последние символы совпали, предпоследние различны. Алгоритм закончил работу.

В итоге, чтобы найти одно вхождение образца длиной [math]m = 8[/math] в образце длиной [math]n = 24[/math], нам понадобилось [math]17[/math] сравнений символов.

Асимптотики[править]

  • Фаза предварительных вычислений требует [math]O(m^2 + \sigma)[/math] времени и памяти.
  • В худшем случае поиск требует [math]O(m \cdot n)[/math] сравнений.
  • В лучшем случае требует [math] \Omega \left( \dfrac{n}{m} \right)[/math] сравнений.

Пример: Исходный текст [math]bb \dots bb[/math] и шаблон [math]abab \dots abab[/math]. Из-за того, что все символы [math]b[/math] из текста повторяются в шаблоне [math]\dfrac{m}{2}[/math] раз, эвристика хорошего суффикса будет пытаться сопоставить шаблон в каждой позиции (суммарно, [math]n[/math] раз), а эвристика плохого символа в каждой позиции будет двигать строку [math]\dfrac{m}{2}[/math] раз. Итого, [math]O(n \cdot m)[/math].

где [math]n[/math] — длина исходного текста, [math]m[/math] — длина шаблона, [math]\sigma[/math] — размер алфавита.

Варианты[править]

Алгоритм Бойера — Мура — Хорспула[править]

Этот алгоритм работает лучше Бойера-Мура на случайных текстах — для него оценка в среднем лучше. Алгоритм использует только сдвиги плохих символов, при этом за такой символ берётся символ из исходного текста, который соответствует последнему символу шаблона, независимо от того, где случилось несовпадение. Поскольку реальные поисковые образцы редко имеют равномерное распределение, алгоритм Бойера-Мура-Хорспула может дать как выигрыш, так и проигрыш по сравнению с стандартной реализацией.

Алгоритм Чжу — Такаоки[править]

На коротких алфавитах сдвиги плохих символов не помогают уже на коротких суффиксах. Простейший способ улучшить работу алгоритма в таких условиях — вместо одного плохого символа строить таблицу для пары символов: несовпавшего и идущего перед ним. Такой алгоритм получил собственное имя: алгоритм Чжу — Такаоки. На предварительную обработку расходуется [math]O(m+\sigma^2)[/math] времени.

Сравнение с другими алгоритмами[править]

Достоинства[править]

  • Алгоритм Бойера-Мура на хороших данных очень быстр, а вероятность появления плохих данных крайне мала. Поэтому он оптимален в большинстве случаев, когда нет возможности провести предварительную обработку текста, в котором проводится поиск.
  • На больших алфавитах (относительно длины шаблона) алгоритм чрезвычайно быстрый и требует намного меньше памяти, чем алгоритм Ахо-Корасик.
  • Позволяет добавить множество модификаций, таких как поиск подстроки, включающей любой символ (?) (но для реализации множества символов (*) не подходит, так как длина шаблона должна быть известна заранее).

Недостатки[править]

  • Алгоритмы семейства Бойера-Мура не расширяются до приблизительного поиска, поиска любой строки из нескольких.
  • На больших алфавитах (например, Юникод) может занимать много памяти. В таких случаях либо обходятся хэш-таблицами, либо дробят алфавит, рассматривая, например, 4-байтовый символ как пару двухбайтовых.
  • На искусственно подобранных неудачных текстах скорость алгоритма Бойера-Мура серьёзно снижается.

Источники информации[править]